SGN Marker solcap_snp_sl_28472

SGN-M21390

Synonyms  
SL1_00sc6004_2482670
SL1_00sc6004_2482670_solcap_snp_sl_28472
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70601)
Chromosome
11
Position
89.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67085)
Chromosome
11
Position
93.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63551)
Chromosome
11
Position
106.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57721)
Chromosome
11
Position
52.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTGCTATATAGCCAAAGCGCACGATCCTACAAAATTGTTCCTACAACTC
  
3' flanking region
GGAGTGTCATTACATGATATTCACTCAGAACCCATGTAGGGTTTACATTA
SNP nucleotide
AG
SNPdb format
ACTGCTATATAGCCAAAGCGCACGATCCTACAAAATTGTTCCTACAACTC[A/G]
GGAGTGTCATTACATGATATTCACTCAGAACCCATGTAGGGTTTACATTA
  
Genomic location of solcap_snp_sl_28472  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21390 marker 21390
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)