SGN Marker solcap_snp_sl_28474

SGN-M21392

Synonyms  
SL1_00sc6004_2483082
SL1_00sc6004_2483082_solcap_snp_sl_28474
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70603)
Chromosome
11
Position
89.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67086)
Chromosome
11
Position
93.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63552)
Chromosome
11
Position
106.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57723)
Chromosome
11
Position
52.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCAACTGCAGTGACACCATGACTTCTCTTGTGAGCTAGGGTCAAATGGGC
  
3' flanking region
TTCTGAATGCAGCTCTCCAGGCTTTTGTCCTTCAAGAAATCACCAACCTT
SNP nucleotide
TC
SNPdb format
GCAACTGCAGTGACACCATGACTTCTCTTGTGAGCTAGGGTCAAATGGGC[T/C]
TTCTGAATGCAGCTCTCCAGGCTTTTGTCCTTCAAGAAATCACCAACCTT
  
Genomic location of solcap_snp_sl_28474  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21392 marker 21392
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)