SGN Marker solcap_snp_sl_28499

SGN-M21395

Synonyms  
SL1_00sc6004_2630522
SL1_00sc6004_2630522_solcap_snp_sl_28499
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70608)
Chromosome
11
Position
90.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57726)
Chromosome
11
Position
52.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGACGAGAGAATTTGGGTGATGTCGACAGTGATGACGATGATGATGAC
  
3' flanking region
GAGGAGGAGGCGCTTACGTGCTGGGGTTTTCCGATGGTGAGGAGGGGGAA
SNP nucleotide
AG
SNPdb format
AGAGACGAGAGAATTTGGGTGATGTCGACAGTGATGACGATGATGATGAC[A/G]
GAGGAGGAGGCGCTTACGTGCTGGGGTTTTCCGATGGTGAGGAGGGGGAA
  
Genomic location of solcap_snp_sl_28499  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21395 marker 21395
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)