SGN Marker solcap_snp_sl_28503

SGN-M21397

Synonyms  
SL1_00sc6004_2664248
SL1_00sc6004_2664248_solcap_snp_sl_28503
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70609)
Chromosome
11
Position
90.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67090)
Chromosome
11
Position
94.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63556)
Chromosome
11
Position
110.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57728)
Chromosome
11
Position
52.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATCAAGTCCTTCCATCTCTTTACACTCTTCAGGGCAGCTCAAGGGTTAT
  
3' flanking region
CTTCGCAGTTTGCCAATGGGGTTGGACCTATTAGAGCCAACATGCAAACT
SNP nucleotide
TC
SNPdb format
CATCAAGTCCTTCCATCTCTTTACACTCTTCAGGGCAGCTCAAGGGTTAT[T/C]
CTTCGCAGTTTGCCAATGGGGTTGGACCTATTAGAGCCAACATGCAAACT
  
Genomic location of solcap_snp_sl_28503  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21397 marker 21397
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)