SGN Marker solcap_snp_sl_28539

SGN-M21401

Synonyms  
SL1_00sc6004_2904944
SL1_00sc6004_2904944_solcap_snp_sl_28539
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70611)
Chromosome
11
Position
92.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57732)
Chromosome
11
Position
53.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGTATGAAGTGGATGTGCAGAGAGAGAGAATCTTTTCACGGGCAGGGGC
  
3' flanking region
GTTGATAGAAGTGGGACTGTAAAATTGGGGAAAAAGCATGAAAGGTCGAG
SNP nucleotide
TC
SNPdb format
ATGTATGAAGTGGATGTGCAGAGAGAGAGAATCTTTTCACGGGCAGGGGC[T/C]
GTTGATAGAAGTGGGACTGTAAAATTGGGGAAAAAGCATGAAAGGTCGAG
  
Genomic location of solcap_snp_sl_28539  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21401 marker 21401
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)