SGN Marker solcap_snp_sl_28544

SGN-M21405

Synonyms  
SL1_00sc6004_2907837
SL1_00sc6004_2907837_solcap_snp_sl_28544
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70615)
Chromosome
11
Position
92.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67093)
Chromosome
11
Position
95.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63559)
Chromosome
11
Position
111.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57736)
Chromosome
11
Position
53.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCCTGGAGATGGAAATAAGTTGTTATGTCAGCAAAACTCAACTGATAAT
  
3' flanking region
TTGTTGGTGAAACATGTGGTGGAGAACCACCAGCTTGATTGTGGAAAGAG
SNP nucleotide
TC
SNPdb format
CTCCTGGAGATGGAAATAAGTTGTTATGTCAGCAAAACTCAACTGATAAT[T/C]
TTGTTGGTGAAACATGTGGTGGAGAACCACCAGCTTGATTGTGGAAAGAG
  
Genomic location of solcap_snp_sl_28544  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21405 marker 21405
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)