SGN Marker solcap_snp_sl_28561

SGN-M21408

Synonyms  
SL1_00sc6004_2971331
SL1_00sc6004_2971331_solcap_snp_sl_28561
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70618)
Chromosome
11
Position
92.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67095)
Chromosome
11
Position
96.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63561)
Chromosome
11
Position
113.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57739)
Chromosome
11
Position
53.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTGCAAAAGGAACGCGATAACTCATGTTTGAAGCAGCACTTATGGTTGT
  
3' flanking region
CCGTTTGAATACTTGCTTCCCATGGTGTGTGAAGTGCCACCATTCATAGA
SNP nucleotide
AT
SNPdb format
GCTGCAAAAGGAACGCGATAACTCATGTTTGAAGCAGCACTTATGGTTGT[A/T]
CCGTTTGAATACTTGCTTCCCATGGTGTGTGAAGTGCCACCATTCATAGA
  
Genomic location of solcap_snp_sl_28561  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21408 marker 21408
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)