SGN Marker solcap_snp_sl_28596

SGN-M21420

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57751)
Chromosome
11
Position
28.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCGATAAATCCCTACCTTTCGATCACCATCAGGGGGATATTAAAGAGGG
  
3' flanking region
AAGAAGGAATGAAAAACCTATATATAGTATATTACTGTTTCTTTGAGTCT
SNP nucleotide
AG
SNPdb format
CTCGATAAATCCCTACCTTTCGATCACCATCAGGGGGATATTAAAGAGGG[A/G]
AAGAAGGAATGAAAAACCTATATATAGTATATTACTGTTTCTTTGAGTCT
  
Genomic location of solcap_snp_sl_28596  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21420 marker 21420
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)