SGN Marker solcap_snp_sl_2879

SGN-M21435

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57766)
Chromosome
4
Position
0.34 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTGAATGGGGAATTTACAATTTCAGTACCAGACATAGATGGTCTAGCAT
  
3' flanking region
ACTTGAATTTGCAAAGGGGAAGCCGTTGCTATGGCCTTTCCAAGCATCTT
SNP nucleotide
AG
SNPdb format
ACTGAATGGGGAATTTACAATTTCAGTACCAGACATAGATGGTCTAGCAT[A/G]
ACTTGAATTTGCAAAGGGGAAGCCGTTGCTATGGCCTTTCCAAGCATCTT
  
Genomic location of solcap_snp_sl_2879  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21435 marker 21435
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)