SGN Marker solcap_snp_sl_28846

SGN-M21455

Synonyms  
SGN-U575165_snp853
SGN-U575165_snp853_solcap_snp_sl_28846
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70420)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66948)
Chromosome
12
Position
0.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63427)
Chromosome
12
Position
1.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57786)
Chromosome
12
Position
0.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGCTGATAGCTGACTGGTAGTCTTTACCTCACAGTCTTGTGGAGTGTC
  
3' flanking region
TTGATTTTGCTTGGATCATATCCGAAACTTGCTAAGTAGTTCTTGTACCT
SNP nucleotide
AT
SNPdb format
ATTGCTGATAGCTGACTGGTAGTCTTTACCTCACAGTCTTGTGGAGTGTC[A/T]
TTGATTTTGCTTGGATCATATCCGAAACTTGCTAAGTAGTTCTTGTACCT
  
Genomic location of solcap_snp_sl_28846  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21455 marker 21455
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)