SGN Marker solcap_snp_sl_28890

SGN-M21456

Synonyms  
SGN-U577657_snp19916
SGN-U577657_snp19916_solcap_snp_sl_28890
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70437)
Chromosome
12
Position
0.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66962)
Chromosome
12
Position
2.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63439)
Chromosome
12
Position
2.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57787)
Chromosome
12
Position
0.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGATTGATGGTGTAGAAGGTTAATGCAATGCTTCATGTAAAGAAGAACA
  
3' flanking region
TGAGTGGAGATTTAAGATTATATAAGATTAGAAATAATTATATTCAGGAA
SNP nucleotide
AC
SNPdb format
TGGATTGATGGTGTAGAAGGTTAATGCAATGCTTCATGTAAAGAAGAACA[A/C]
TGAGTGGAGATTTAAGATTATATAAGATTAGAAATAATTATATTCAGGAA
  
Genomic location of solcap_snp_sl_28890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21456 marker 21456
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)