SGN Marker T1627

SGN-M2146
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZAA77TH
Arabidopsis best BAC match: AC004521.2
Arabidopsis position: 2.2390000
Arabidopsis identities: 0.673
Best GenBank protein hit: AAC16080.1
Evalue: 1.7e-45
Identities: 0.635
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49466)
Chromosome
1
Position
70.30 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47400)
Chromosome
1
Position
49.18 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39713)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1627 was used as an overgo probe on plate 9 [well E2]

Plausible BAC Matches:   P271J03

 Overgo Sequences

A sequence
GCCTTATGTTGGAGGTAATGCACC
B sequence
ATCTGGTGTAGGAGCTGGTGCATT
AB sequence
GCCTTATGTTGGAGGTAATGCACCAGCTCC
Marker sequence
GTGTAATTGGAAATTCAGACACAGAAAAGGACAAAGAAGAGTGTACACAA
TCATTGATTGGTCTGGCAACATGTTTGCCTTATGTTGGAGGTAATGCACC
AGCTCCTACACCAGATTGCTGTACTGGATTGAAACAAGTGTTGAAAGATA
GCAAGAAGTGTCTTTGTTTGTTAATTAAGGACAGAAATGATCCTGATTTG
GGACTTCAACTCAATGTTACACTTGCTTTAACACTCCCCTCTGTTTGTAA
AGCCCCTGCTAATATTTCTGAATGCCCTGCACTTCTCCACTTGCCTGCAA
ATTCACCAGATGCTCAAGTATTCTATCAAATTGCTAATAATTCAAGCAGC
ATTGCTGGTAGTCCACTTGCACATAGCCCCATTCCTTCTGTTGGATCTAG
TCCTACAGGTGCCCCTGCTGGTGCTCCTAAATCTGCTGGTTGTCATATTG
GAAAGAGATATTTTGGATTAGAAGCAATTGTTGGTGTAGTCCTTCTTTGG
TCTTTAACTTCAAATTTCTTCATAGGATGAGTTTAATAACCTTATTTTGT
ATCATAATAATCAAAGCTATCACTTTGTTAAATGG
Genomic location of T1627  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2146 marker 2146
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)