SGN Marker T1629

SGN-M2147
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZAA81TV
Arabidopsis best BAC match: AL049711.3
Arabidopsis position: 3.1170000
Arabidopsis identities: 0.761
Best GenBank protein hit: CAB41332.1
Evalue: 4.5e-61
Identities: 0.692
Description: gamma response I protein [Arabidopsis thaliana]
Comment: unclear characterization
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49467)
Chromosome
1
Position
73.57 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47401)
Chromosome
1
Position
49.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39714)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1629 was used as an overgo probe on plate 8 [well E12]

Plausible BAC Matches:   P175O24

 Non-Plausible BAC matches

P104D02,   P168G04,   P211P06,   P060J24,   P072A06

 Overgo Sequences

A sequence
CGGATTGTTCAGTGGATTTGGCCT
B sequence
GCTAGGCTACAAGTACAGGCCAAA
AB sequence
CGGATTGTTCAGTGGATTTGGCCTGTACTT
Marker sequence
GAAGTAGTATGTAAACCAGAATAACATCAACTTCTAAATACTGTCTTCCT
GAAGAAAAAGCTATAACAAACACAAGTGACTCCAATACAGAGGTAGCCCG
GGTAGACGACAATCAGTTTGCCTCAGTAGTATGCTTTCCGCGGATTGTTC
AGTGGATTTGGCCTGTACTTGTAGCCTAGCATCATCCGTTTCTTATATTG
ATCATAGATATCATCTTCTGGAGTGACCTCTCCAGGTTGGTGAGCACCAA
CACCTAAGTTATTTGATTTTATACTGCCAGCTGCTATTGGATCTGCAATA
CCACTTTTAGAACTCCCTAGTCCTTCACCTTCTCTCCAACCCATTTTCGA
TAGAAGTTTGTGGCCAATATTATCAGCTTGTATTTTCGACCTTTCTGCTG
CCTCTATGGCTGCTTTCCGAGCACCTACGTCGTTGCAGGTAGACAAAAAC
TTAGCAAGCTCTTCAGGTGGGATATAGTCCCCCATATGATGACCCTTCTT
TCCTGGAACTTGGAGAGAAGCAGGTGGAGGCATCTCATCTTTCGATGATC
TCGGTGCCCTCAGTT
Genomic location of T1629  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2147 marker 2147
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)