SGN Marker solcap_snp_sl_29022

SGN-M21475

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71894)
Chromosome
10
Position
27.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68197)
Chromosome
10
Position
37.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64585)
Chromosome
10
Position
59.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57806)
Chromosome
10
Position
30.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGGAGAGTAAATTGGATTTTCCAACTCCAGAATCTCCGATTAACACAAT
  
3' flanking region
TTGAACAAGTAATCGTACTCTTCGTCTGCTCTCCTTGCCATTTCTCCTTC
SNP nucleotide
TC
SNPdb format
CTGGAGAGTAAATTGGATTTTCCAACTCCAGAATCTCCGATTAACACAAT[T/C]
TTGAACAAGTAATCGTACTCTTCGTCTGCTCTCCTTGCCATTTCTCCTTC
  
Genomic location of solcap_snp_sl_29022  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21475 marker 21475
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)