Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_29322

SGN-M21506

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71915)
Chromosome
4
Position
91.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68207)
Chromosome
4
Position
106.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57837)
Chromosome
4
Position
63.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGTCGACGATGATGAGCCAGCCATGGGAAGAGCCGCATCGTCGTCGGCTG
  
3' flanking region
TTGAAGCCTCAGGAAGATTGAGAAAGTGAACCTTGTTGTCAACGAAGTTG
SNP nucleotide
TC
SNPdb format
CGTCGACGATGATGAGCCAGCCATGGGAAGAGCCGCATCGTCGTCGGCTG[T/C]
TTGAAGCCTCAGGAAGATTGAGAAAGTGAACCTTGTTGTCAACGAAGTTG
  
Genomic location of solcap_snp_sl_29322  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21506 marker 21506
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)