SGN Marker solcap_snp_sl_2938

SGN-M21513

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57844)
Chromosome
10
Position
58.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGCCAAAAGCACACCAAAGCTTGCAGATGAAAGTTACCCGGAGGAAGAAG
  
3' flanking region
ACATGGTGAGACACTCTGCGGCAGCTGTGGTGGGAATTATAGTGCTGATG
SNP nucleotide
AG
SNPdb format
GGCCAAAAGCACACCAAAGCTTGCAGATGAAAGTTACCCGGAGGAAGAAG[A/G]
ACATGGTGAGACACTCTGCGGCAGCTGTGGTGGGAATTATAGTGCTGATG
  
Genomic location of solcap_snp_sl_2938  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21513 marker 21513
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)