SGN Marker T1636

SGN-M2152
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZAU55TH
Arabidopsis best BAC match: AC009853.2
Arabidopsis position: 3.0110000
Arabidopsis identities: 0.805
Best GenBank protein hit: AAF02167.1
Evalue: 1.4e-51
Identities: 0.803
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49468)
Chromosome
6
Position
1.64 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47402)
Chromosome
6
Position
4.23 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39717)
Chromosome
6
Position
5.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1636 was used as an overgo probe on plate 2 [well C5]

Plausible BAC Matches:   P185J10,   P026K16,   P336O09

 Overgo Sequences

A sequence
CACGAATCGCTCGAAACACTTCTC
B sequence
CCGAAGGAGGATGATAGAGAAGTG
AB sequence
CACGAATCGCTCGAAACACTTCTCTATCAT
Marker sequence
GCGCTTATCTACGGAGATTTGCTTCACGAATCGCTCGAAACACTTCTCTA
TCATCCTCCTTCGGATCCTCAATCGCTCGATCTTCCGCTTCATCGTCGAC
GCCGTCGGCTTCCGCCAAGGTCGCCGATCGGATTGTCAAGCTATCAGCTG
TCGATCCAGACGGTAACAAACGCGATGTTGTCGGACTCTCGGGTCAAACA
CTGCTCAAAGCACTAACGAATCAGGGGTTAATTGACCCAGATTCTCATCG
GCTTGAAGATATCGATGCTTGTTCAGCTGAATGTGAGGTACACATTGCTC
AGGAATGGCTCGAGAAGCTTCCACCAGCTTCGTATGATGAAAAGTATGTT
TTGAAGAGGAATTCTAGAGCTAGGGTTTTGAACAAGCACTCTAGGCTTGG
ATGTCAGGTGGATCTTTCCCAGGAACTTCAAGGTATGGTTGTGGCACTTC
CTGAACCCAAGCCTTGGGATATCCCGTAAGGTGAAATGAAAATTTGTTGA
GGTTTTTGAATTGGAATTATAGTGTTTTGTGATGATAATGATAATATATG
GAAACTTTCGGTACTCGATGATGTGTCTTTGTTAATTACTCAGTATGTTA
AGCCATTGGAATGTTCCCAATTCGAAGTAAGTGGCAAT
Genomic location of T1636  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2152 marker 2152
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)