SGN Marker T1640

SGN-M2155
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TRZAU72TH
Arabidopsis best BAC match: AC011664.8
Arabidopsis position: 3.0036000
Arabidopsis identities: 0.857
Best GenBank protein hit: CAA56521.1
Evalue: 4.1e-93
Identities: 0.978
Description: mitochondrial processing peptidase [Solanum tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49469)
Chromosome
5
Position
5.72 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47403)
Chromosome
5
Position
69.30 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39719)
Chromosome
5
Position
57.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35609
Forward primer (5'-3')
TGGACAGACCCTGATTCCAT
Digested band sizes (using KpnI)
Solanum lycopersicum LA925: 700+1300
Solanum pennellii LA716: 2000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCGACTGGGAAAAGAAGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 71
Forward primer (5'-3')
Unknown
Digested band sizes (using KpnI)
Solanum lycopersicum LA925: 700+1300
Solanum pennellii LA716: 2000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1640 was used as an overgo probe on plate 11 [well H10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P264D11,   P067L23,   P106F21,   P148K20,   P161B11,   P188D06

 Overgo Sequences

A sequence
CGGATCATGGAGCAAAAGTTCAGG
B sequence
CATGTGCTTTCCTCCTCCTGAACT
AB sequence
CGGATCATGGAGCAAAAGTTCAGGAGGAGG
Marker sequence
GTAGTGGAGCGTCATGGACAGACCCTGATTCCATAGTTTTGATGGTCATG
CAACAAATGCTCGGATCATGGAGCAAAAGTTCAGGAGGAGGAAAGCACAT
GGGTTCAGAGCTTGTTCAGAGGGTGGCCATCAATGAGCTAGCTGAAAGTG
TGATGGCTTTTAACACCAACTATAAAGATACAGGGCTGTTTGGTGTCTAT
GCTGAAGCTAAGCCTGATTGCCTGAGTGACTTGGCTTATGTCATCATGAA
TGGTATATGCAAGTTAAGTTACAAAGTGTCTGATGCTGATGTGGTTCGCG
CACGTAATCAGCTGAAATCTTCTTTGATGCTCCACATTGATGGATCAGGC
CCTACTGCTGAAGACATTGGACGGCAGTTAATCACATATGGCCGCAGAAT
TCCATATGCTGAGTTATTTTCCAGAATTGACAGTGTCGATGCTGGAACGA
TCAAGCGAGTTGCAAATCGTTTTATTTTTGACAGGGATGTTGCAATATCA
GCTAGGGGACCAATTCAAGATTTGCCTGATTACAATTGGTTCAGACGCAG
GACATACTGGCTGCGGTACTAGATTGCTAATTCTTTCCTGATGACTTAAA
TTCATCTTCTTTTCCCAGTCGGAATCGGGACATTGGGCATTATACCACAC
ATGGTCTACAAAACACTTTTGTCAATAAAATGAGCGACAAATTTTGTTGA
TCACTTTTG
Genomic location of T1640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2155 marker 2155
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)