SGN Marker T1648

SGN-M2159
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBB82TH
Arabidopsis best BAC match: AC006922.6
Arabidopsis position: 2.2020000
Arabidopsis identities: 0.774
Best GenBank protein hit: AAD31572.1
Evalue: 2.5e-22
Identities: 0.718
Description: putative xyloglucan endo-transglycosylase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49471)
Chromosome
11
Position
49.08 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47405)
Chromosome
11
Position
78.41 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42386)
Chromosome
12
Position
105.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39721)
Chromosome
11
Position
61.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 11847)
Chromosome
12
Position
104.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T1648 was used as an overgo probe on plate 1 [well H4]

Plausible BAC Matches:   P158A21,   P249E07

 Overgo Sequences

A sequence
ATTCTCAAAGTCCCCCTTCACCTG
B sequence
GAACTAGGATAGTAGCCAGGTGAA
AB sequence
ATTCTCAAAGTCCCCCTTCACCTGGCTACT
Marker sequence
GGATTTTATATCCAAACAATTATTATGGAATTCCTTCTTTATTTACTTTT
ATTTTTCTTACTCAATTCAAGATTAATCAATTCTCAAAGTCCCCCTTCAC
CTGGCTACTATCCTAGTTCTAGGGCACAATCTATAGGATTTAACCAAGGT
TTTAGAAACCTTTGGGGTCCTCAACATCAATCATTGGACCAAAGTACCTT
AACTATATGGCTTGATAAAAATTCACGAGGAAGTGGGTTTAAATCTCTAA
AGAAATATCGTTCCGGTTATTTTGGGAGTAGTATTAAGCTACAACCTGGT
TTTACTGCTGGAATTATTACTTC
Genomic location of T1648  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2159 marker 2159
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)