SGN Marker solcap_snp_sl_2984

SGN-M21592

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57923)
Chromosome
11
Position
31.83 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAGAAGAAGGAACATGGAGGATTAGAAACCCTAAAAAAAATCTGACATT
  
3' flanking region
AAATTGAAGAAATGCCATTCAATGGAGTATTGCTGGTGTCTGTAGCTAAA
SNP nucleotide
AG
SNPdb format
TAAGAAGAAGGAACATGGAGGATTAGAAACCCTAAAAAAAATCTGACATT[A/G]
AAATTGAAGAAATGCCATTCAATGGAGTATTGCTGGTGTCTGTAGCTAAA
  
Genomic location of solcap_snp_sl_2984  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21592 marker 21592
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)