SGN Marker T1650

SGN-M2161
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBB86TH
Arabidopsis best BAC match: AP000604.1
Arabidopsis position: 3.0605000
Arabidopsis identities: 0.818
Best GenBank protein hit: AAF58355.1
Evalue: 1.3e-42
Identities: 0.478
Description: CG6152 gene product [alt 2] [Drosophila melanogaster]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49472)
Chromosome
1
Position
2.66 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47406)
Chromosome
1
Position
23.61 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39723)
Chromosome
1
Position
22.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1650 was used as an overgo probe on plate 3 [well F8]

Plausible BAC Matches:   P262O22

 Overgo Sequences

A sequence
CGACAACATCTGGAAGCACAGCAT
B sequence
CCAGCTGCAAGAGAATATGCTGTG
AB sequence
CGACAACATCTGGAAGCACAGCATATTCTC
Marker sequence
GCAAGGAATATCTCGATTCAATTCTTCGTGGTCCCATAAGCATTACACTG
AGGCATCGTCTCCAGTGTCACGTGATTAGAGATTCAGCTAAAAGTGATCT
GGATAGTGAAGAGCCCATACTTGTTCTCAACGAAGTCACAATTGACCGTG
GGATTTCATCATTTTTAACAAATCTAGAATGCTATTGCGATAATTCTTTT
GTTACTTGCGTACAAAGGGATGGCTTAATTTTATCGACAACATCTGGAAG
CACAGCATATTCTCTTGCAGCTGGAGGATCAATGGTCCATCCTCAGGTTC
CCGGCATCCTCTTTACACCTATCTGCCCACATTCTTTATCCTTTCGCCCT
CTCATTTTGCCCGAGTATGTGACAATACGAGTACAAGTACCTTTCAACAG
CAGAGGTCATGCATGGGCGTCATTTGATGGAAAAGACAGGAAAAAGTTAG
CACCGGGAGACGCCCTTGTTTGTAGCATGGCAACTTGGCCTGTACCAACT
GCATGTCAAGCTGATT
Genomic location of T1650  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2161 marker 2161
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)