SGN Marker solcap_snp_sl_29940

SGN-M21614

Synonyms  
SGN-U564058_snp1352
SGN-U564058_snp1352_solcap_snp_sl_29940
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70377)
Chromosome
3
Position
45.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66909)
Chromosome
3
Position
45.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63391)
Chromosome
3
Position
47.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57945)
Chromosome
3
Position
21.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCAAGAAAAATGGAAGCAAATCCCTTCTAGATGGGGACTTAAACTCACC
  
3' flanking region
GCCTTGCCCATGGTCTAGTAGCTAAGTCTAATGAAACTTGTTTTTATACC
SNP nucleotide
AG
SNPdb format
TCCAAGAAAAATGGAAGCAAATCCCTTCTAGATGGGGACTTAAACTCACC[A/G]
GCCTTGCCCATGGTCTAGTAGCTAAGTCTAATGAAACTTGTTTTTATACC
  
Genomic location of solcap_snp_sl_29940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21614 marker 21614
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)