Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1651

SGN-M2162
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TRZBB95TH
Arabidopsis best BAC match: AC007178.5
Arabidopsis position: 2.0180000
Arabidopsis identities: 0.731
Best GenBank protein hit: AAC62611.1
Evalue: 1.6e-74
Identities: 0.714
Description: subtilisin-like protease [Arabidopsis thaliana]
Comment: unclear functional characterization
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39724)
Chromosome
7
Position
45.60 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1651 was used as an overgo probe on plate 1 [well H12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGATATGGAAACGGGACAGCAAAG
B sequence
CTTTTGGTGATCCACCCTTTGCTG
AB sequence
GGATATGGAAACGGGACAGCAAAGGGTGGA
Marker sequence
ATTTCAACAAAGGGTACGCTACACTAGCAGGATCGCTAAATTCAACCTTC
AATACACCGCGAGACACTGATGGCCATGGTTCCCACACGTTGTCCACAGC
CGGTGGAAACTTTGTTGAAAGATCAAGTGTTTTCGGATATGGAAACGGGA
CAGCAAAGGGTGGATCACCAAAAGCAAGAGTAGCAGCTTACAAAGTTTGC
TGGACTCCAATTTCAGGCAATGAGTGTTTCGATGCAGACATCTTGGCTGC
ATTTGATATGGCTATTCATGATGGCGTTGACGTCCTTTCTGTATCACTAG
GAGGAGATGCAGTACCCTATGCCAATGACAGCATTGCTATCGGTTCGTTT
CATGCTGTTAAGCATGGCATTGTTGTGGTTACCTCTGCTGGTAACTCTGG
TCCTGCTGTTAGTACAGTATCAAACGTTGCACCTTGGGTCATTACTGTCG
GTGCAAGCACTATGGATCGGCAGGTCCCTAGCTATGTAACACTCCGAAAC
AACAAGTGTTACAAGGGAGAAAGCTTATCTGTTGAAGCATTGCCTAAAAG
AAAGTTATTCCCAATCATTACTG
Genomic location of T1651  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2162 marker 2162
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)