SGN Marker TG564

SGN-M217

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGAAAATCGCGTAAAGTTTTCTAACATTTTGAGGTGCAAATGGGGTAGTGATCCTTTGTTCTTTGGTTCATATACTTATTATATAGCTG
TTGGATCAAGTGGAGATGATTTGGATACTGTGGCTGAACCATTGCCTAATAGGATATCAAAGAATTGTCCTCCACTTCAGATATTGTTTG
CAGGTGAAGCAACACATGGATCTTGTTATTCAAACAACTCATGGTGCTTATCTTACTGACCTTAGAGAAACCAATAGGCTTCTTAAACAC
TTTCAATGTGTTGATGTTTCAAATGATTGTTGTTCTTTTTTCTTTTGTTATTTGATATTCATTTGGATCAGGATCTTTGGTTAACGATAA
AGGTATATTTACTCACCGCCAAATTTAACTTTAATCAACTGAAGTTGGGTTCTGAAAAAAGTATCTTTTGGTATCTTTAGTCAGGTCATA
TCATGTCATCTGTAGGCCTTCATTGCAGAA
Reverse sequence
AAGTCAGCAAAATGTCACACCGAGAGTACAGTAGTAGAGCACAGTAGAGTAGGGAGAAGTTGCCTCAAAAGAGGAAAAGAAAAGGTAACG
AACCACACATTTGACAGCTCAAAACCACTTTACCAATCCAAACAAAAAATCATCACATTATCCCTCCCTTCTCTCCTTTCTCTATTACTC
TCATTTTCCCCAAGTTTCAGGTACCTTTTTCCTAACATAATCCGCCCATAGTGTTCATCATTCAAGATCTGTCCTTTTGAGGAGACTTCA
TTCCTTACTATGGTCTTCTTTTTTTGATGATTTCTTATGTGAGATGTTGAAAACTGGAAAGAAGTGATAAAGATAGGAGGTTTGGTTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1655583.4e-0584 (17.5% of RFLP seq)+
SGN-U1601372.2e-06110 (22.9% of RFLP seq)+
SGN-U1655582.2e-0947 (9.8% of RFLP seq)+
SGN-U1727495.3e-65160 (44.7% of RFLP seq)-
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43021)
Chromosome
3
Position
6.40 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44021
Forward primer (5'-3')
TGAGGTGCAAATGGGGTAGTG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GCAATGAAGGCCTACAGATGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42488)
Chromosome
3
Position
63.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 8626)
Chromosome
3
Position
67.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8625)
Chromosome
3
Position
30.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG564 was used as an overgo probe on plate 2 [well C12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P285H10,   P016M05,   P146P04,   P240O13,   P317A01,   P048I10

 Overgo Sequences

A sequence
GCTGTTGGATCAAGTGGAGATGAT
B sequence
CAGCCACAGTATCCAAATCATCTC
AB sequence
GCTGTTGGATCAAGTGGAGATGATTTGGAT
Marker sequence
AAGAAAATCGCGTAAAGTTTTCTAACATTTTGAGGTGCAAATGGGGTAGT
GATCCTTTGTTCTTTGGTTCATATACTTATTATATAGCTGTTGGATCAAG
TGGAGATGATTTGGATACTGTGGCTGAACCATTGCCTAATAGGATATCAA
AGAATTGTCCTCCACTTCAGATATTGTTTGCAGGTGAAGCAACACATGGA
TCTTGTTATTCAAACAACTCATGGTGCTTATCTTACTGACCTTAGAGAAA
CCAATAGGCTTCTTAAACACTTTCAATGTGTTGATGTTTCAAATGATTGT
TGTTCTTTTTTCTTTTGTTATTTGATATTCATTTGGATCAGGATCTTTGG
TTAACGATAAAGGTATATTTACTCACCGCCAAATTTAACTTTAATCAACT
GAAGTTGGGTTCTGAAAAAAGTATCTTTTGGTATCTTTAGTCAGGTCATA
TCATGTCATCTGTAGGCCTTCATTGCAGAA
Genomic location of TG564  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D217 marker 217
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)