SGN Marker T1659

SGN-M2170
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBC41TH
Arabidopsis best BAC match: AC000098.1
Arabidopsis position: 1.0130000
Arabidopsis identities: 0.828
Best GenBank protein hit: AAB71466.1
Evalue: 2.5e-64
Identities: 0.787
Description: similar to Caenorhabditis unknown protein T03F1.1 (gb|U88169). [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49475)
Chromosome
3
Position
56.00 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47409)
Chromosome
3
Position
69.44 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40817)
Chromosome
3
Position
83.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36566
Forward primer (5'-3')
TGGTCGCCTTTTGTTGTATG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CAGCAGCATCTGTCTTTGTCA
Digested band sizes (using Tsp509I)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39727)
Chromosome
3
Position
84.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1659 was used as an overgo probe on plate 7 [well A4]

Plausible BAC Matches:   P260A05

 Overgo Sequences

A sequence
ATCCCTATAGCAGGCTTATGGCAC
B sequence
ATACCCATCCTCTGGAGTGCCATA
AB sequence
ATCCCTATAGCAGGCTTATGGCACTCCAGA
Marker sequence
GCATGGAGGTGGAGCTCAAAGAATTGCTGAGTGATCTCCATTCTCTCAAG
AAATCAATCTCAGATCCTTCTCATCTTGCTCTAATCGAAAAGATGCATTT
GCATGCTGAAAACATCGCTACTCTTGAGAAGTCGGGAACTATTCGCCGTT
CAAAAGTCAAGGATATGAGTGCTGAAGTTGTTGATAGCAATCCCTATAGC
AGGCTTATGGCACTCCAGAGGATGGGTATTGTGAATAACTATGAAAGAAT
AAGAGAGTTCTCAGTTGCCATTGTTGGCATAGGTGGTGTTGGCAGTGTTG
CTGCTGAGATGCTGACAAGGTGTGGCATTGGTCGCCTTTTGTTGTATGAT
TATGACAAAGTGGAGTTAGCTAATATGAATAGGCTATTTTTTTCGCCCAG
AGCAGGTCGGTATGACAAAGACAGATGCTGCTGTACAAACTCTTTCAGAG
ATAAATCCTGATGTTGTGCTTGAGAGCTACACGTTAAATATAACAACCGT
GGAAGGTTTTGACACATTTATGTCAAGTCTTACAAACAAATCATTCCGGC
CAACTAA
Genomic location of T1659  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2170 marker 2170
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)