SGN Marker solcap_snp_sl_30309

SGN-M21709

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72048)
Chromosome
10
Position
28.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68293)
Chromosome
10
Position
39.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64678)
Chromosome
10
Position
59.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58040)
Chromosome
10
Position
50.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAAATGCAATCAGGACAGGTTCGTTGTTGAAGATATTGTCAAATTCGGG
  
3' flanking region
CGGGTTTCCGGTTTGGTCTTGAAGCTGGGTCAAAACCTGAGCTCCTCCTG
SNP nucleotide
AT
SNPdb format
TAAAATGCAATCAGGACAGGTTCGTTGTTGAAGATATTGTCAAATTCGGG[A/T]
CGGGTTTCCGGTTTGGTCTTGAAGCTGGGTCAAAACCTGAGCTCCTCCTG
  
Genomic location of solcap_snp_sl_30309  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21709 marker 21709
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)