SGN Marker T1662

SGN-M2172
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBC76TH
Arabidopsis best BAC match: AF069442.1
Arabidopsis position: 4.0180000
Arabidopsis identities: 0.700
Best GenBank protein hit: AAC79106.1
Evalue: 5.4e-23
Identities: 0.401
Description: putative inhibitor of apoptosis [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49476)
Chromosome
1
Position
72.18 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47410)
Chromosome
1
Position
49.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39729)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1662 was used as an overgo probe on plate 9 [well G4]

Plausible BAC Matches:   P279D09

 Overgo Sequences

A sequence
AGGCATAGATGGAAGCTATGCCAG
B sequence
AAAGTCGGTCAGTTGGCTGGCATA
AB sequence
AGGCATAGATGGAAGCTATGCCAGCCAACT
Marker sequence
GGATCTTCTCTACTCTTTCTCTAATCTCCATGCTCTTAGATTTATCCTAC
CCTTTGATTTGCTCAAAACTTTTTAGCTCTAAATCTGGGTAGATGGAAGC
AGGAAAAGAATGCCACGGAAGATTTACCTTAGGCAGGCTAGTTCATTAAG
GAAAGAGAGAGAACCAGATTGAAACTTCAGCCAAATCCAAGGAGGATATG
ACCAAATTAAAAGCTGAAAGTAGTTTACAAAAGTATAAAGATGATATTGA
AAGGCTAGAAAAGGAAATATCCCAGCTCAGACCTAAAGACTGATTCTTCA
AAGATAGCTGCTCTTAAAAGAGGCATAGATGGAAGCTATGCCAGCCAACT
GACCGACTTTAGAAATGCTCCATTACCAAAAGACACTCAAATCCCTTATA
TCTCCACATTTGTGACAGATTTTGAGGAATATTCTCAGGATGGAGGGGTG
AAACCAGAACCCGAGTGTGTCATGTGCTTGTCCGAGGAGATGTCTGTGGT
TTTTCTGCCATGTGCTCATCAAGTGGTATGCACGACATGCAACGAACTTC
ATGAGAAGCAAGGGATGAAAGAATGTCCTTCTTGTANGAGCCTGATC
Genomic location of T1662  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2172 marker 2172
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)