SGN Marker T1664

SGN-M2173
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBC80TH
Arabidopsis best BAC match: AB008268.1
Arabidopsis position: 5.2820000
Arabidopsis identities: 0.783
Best GenBank protein hit: BAB09869.1
Evalue: 6.4e-44
Identities: 0.616
Description: fructose-bisphosphatase-like protein [Arabidopsis
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49477)
Chromosome
1
Position
85.76 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47411)
Chromosome
1
Position
128.45 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39730)
Chromosome
1
Position
140.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1664 was used as an overgo probe on plate 9 [well G5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTGTGTGGATAACTGATGATGGC
B sequence
TGACAACCACAAACGGGCCATCAT
AB sequence
CCTGTGTGGATAACTGATGATGGCCCGTTT
Marker sequence
CCTCAAAACTACCAATTTTGTACCTTTTTGTACCTGAAAATATGGCTTCT
TCTCCATTTTCTGGAGGGTTAATTAACTCCAGGGTTGATTCACCAATTGC
AATTGGCTGTAAAAATGCTTCAGTAGATTCTGCTAATAGTGGGTTTTCAA
CACTGATGGAGTATATGGGTAAAGGAGGGGTTGATGTGGGTGATGACTTG
GTGTTATTGTTTGGTCACTTAGAATATGCCTCCAAGAAAATTGCTGCTCT
TGTTGCTTGCCCTTTCAATTCCAGCCTCAACAACAATGTTGCCATTGGAA
ATACGGGGACTTCTTCTGATAGAGATAAGCCCAAGCCTCTTGATATTGTT
TCGAATGAGATTATATTGTCGTCTCTTAGAAATTCGGGAAAAGTTGCTGT
AATGGCCTCAGAAGAAGATGAGTGTCCTGTGTGGATAACTGATGATGGCC
CGTTTGTGGTTGTCATGGATCCTTTAGATGGTTCCCGAAATATAGATGCC
TCAATACCCACTGGGACGATATTTGGGATTTACAGACGTCTTGTGGAAAT
TGATCATTTGCC
Genomic location of T1664  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2173 marker 2173
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)