Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_30409

SGN-M21737

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58068)
Chromosome
2
Position
17.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGATTTTGATAGACGAAATGTCTCTTTGATGGATCAGGATCATCTTTGT
  
3' flanking region
TGTCTTCTACTCGTGCAAATGTTGATGATGGGGTGTCTATGGATTATGGC
SNP nucleotide
TG
SNPdb format
GTGATTTTGATAGACGAAATGTCTCTTTGATGGATCAGGATCATCTTTGT[T/G]
TGTCTTCTACTCGTGCAAATGTTGATGATGGGGTGTCTATGGATTATGGC
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_30409  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21737 marker 21737
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)