SGN Marker T1665

SGN-M2174
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.07
Tomato EST read: TRZBC87TH
Arabidopsis best BAC match: AC010155.3
Arabidopsis position: 1.0615000
Arabidopsis identities: 0.820
Best GenBank protein hit: CAB78882.1
Evalue: 2.0e-91
Identities: 0.938
Description: ras-like GTP-binding protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49478)
Chromosome
2
Position
36.08 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47412)
Chromosome
2
Position
56.98 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39731)
Chromosome
2
Position
49.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1665 was used as an overgo probe on plate 10 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GACATCTGGTTGCAGTGTCAACTG
B sequence
AAAGACTTCCCGTCCTCAGTTGAC
AB sequence
GACATCTGGTTGCAGTGTCAACTGAGGACG
Marker sequence
GCAAACAAAACACAAAAAAGAAAGAAAAAAAAAAGGGTAAGAAATCGAAA
GGAAGATTTGTTTACTAAGGGAAAACAATAGTTTTGTTCAATTTTTTTCT
CAATTTGAAGTTGTTGAGAGTAATGGCTGGGTACAGAGCTGAAGATGACT
ATGATTACCTATTCAAGGTGGTACTAATTGGTGATTCAGGTGTTGGCAAA
TCCAATTTGCTTTCAAGATTCACTAGAAATGAGTTTAGTCTAGAGTCTAA
GTCTACAATTGGTGTTGAGTTTGCTACTAAAAGCTTAACTGTTGATAGTA
AAGTCATCAAGGCTCAAATTTGGGACACTGCTGGTCAAGAAAGGTACCGT
GCCATCACCAGCGCTTACTACAGAGGTGCCGTGGGTGCTCTGCTTGTGTA
TGATGTCACTCGACATTCAACATTTGAAAATGTTGAGAGGTGGCTTAAGG
AGTTGAGAGATCATACAGATCCCAACATCGTTGTCATGCTTGTCGGAAAC
AAATCTGATCTACGACATCTGGTTGCAGTGTCAACTGAGGACGGGAAGTC
TTTTGCGGAGAAGGAATCCCTCTACTACATGGAAACTTCTGCCCTCGAAT
CTACAAATGTTGAGAATGCATTTGCTGAAGTTCTCACTCAAATCTACCAC
GTCGTGAGTA
Genomic location of T1665  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2174 marker 2174
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)