SGN Marker solcap_snp_sl_30528

SGN-M21765

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72085)
Chromosome
3
Position
45.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68310)
Chromosome
3
Position
45.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58096)
Chromosome
3
Position
29.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCAGATGGATCATGGTGGCTGACTTCACCAACTTTGACGTCTTGCAAGC
  
3' flanking region
TACAACTGAACTACTTAGTGAACCAGCAAATTGTTTAATACAAACCCCCA
SNP nucleotide
TC
SNPdb format
ATCAGATGGATCATGGTGGCTGACTTCACCAACTTTGACGTCTTGCAAGC[T/C]
TACAACTGAACTACTTAGTGAACCAGCAAATTGTTTAATACAAACCCCCA
  
Genomic location of solcap_snp_sl_30528  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21765 marker 21765
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)