SGN Marker T1668

SGN-M2177
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TRZBD07TH
Arabidopsis best BAC match: AL080253.2
Arabidopsis position: 4.1060000
Arabidopsis identities: 0.745
Best GenBank protein hit: CAB79041.1
Evalue: 3.8e-69
Identities: 0.750
Description: putative protein [Arabidopsis thaliana]
Comment: 1.00E-69 match with gb|AAF01285.1|AF177990_1 (AF177990) gamma-soluble NSF attachment protein; gamma-SNAP
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49479)
Chromosome
2
Position
34.06 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47413)
Chromosome
2
Position
42.48 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39734)
Chromosome
2
Position
37.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1668 was used as an overgo probe on plate 11 [well G5]

Plausible BAC Matches:   P168N10

 Overgo Sequences

A sequence
CTTGGGATGCTGCTAAGCATATGG
B sequence
ATGGTAGCAGCAGACTCCATATGC
AB sequence
CTTGGGATGCTGCTAAGCATATGGAGTCTG
Marker sequence
GGAGAAGCAAGAAAGGAACTCACAGCACATCAGCCATGGGTTCCGATCCT
GAAAAGTTGATCAGCAAAGCCGATAAACTGACAAAACTAAGTTTTACCAG
GTGGAGTATTGATTGGAAAAGTGCTACTGGTTTGTATGAGCAGGCAGCTA
ATGGATTTAGGCTTGCTAAAAGTTATGAGAAGGCAAAAGAAGCATTTGAA
AAAGCTTCAAAAGGACAAGAGATGCTTTCCTCGCCTTGGGATGCTGCTAA
GCATATGGAGTCTGCTGCTACCATGGCAAAGGAACTAGGCAACTGGAAAG
AAGTTGCTGACTTTTATAGAAGGGCCTCTGAGTTGTACAATGAATGTGGG
AGGCCCCAACCTGCGTCTGACGCACTTGGAAAAGGCGCGCGTGCCTTTAG
AAGATGGAGCACCTGATGTAGCTGTTCAGTTGTATACTGAAGCCTGTGCC
ATTCTTGAAGAGGACGGGAAGGAACAAATGGCCTTTGATCTATATCGTGA
TGCTGCAAGGGTTTATCTGAAGCTTGAAAAGTATGAAGATGCTGCAACTA
TCCTAATAAGTTTGGCATTAGCTGCTGACAAGTGCAGCGCAACACATAGC
CAGTGCAAGGCTTATCTTAGTGCAATCATTGTTTACCTATATGCCCAC
Genomic location of T1668  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2177 marker 2177
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)