Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_30631

SGN-M21792

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72101)
Chromosome
3
Position
47.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58123)
Chromosome
3
Position
45.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTCTACCCACTAAATTTGTGCCAGGTCGCCCATGAGATGAAACCTTGTT
  
3' flanking region
TGTGAACTACCCATGTCATTTTTGTCAGCACTAGCTCCATTTCCAAGGTT
SNP nucleotide
TC
SNPdb format
TGTCTACCCACTAAATTTGTGCCAGGTCGCCCATGAGATGAAACCTTGTT[T/C]
TGTGAACTACCCATGTCATTTTTGTCAGCACTAGCTCCATTTCCAAGGTT
  
Genomic location of solcap_snp_sl_30631  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21792 marker 21792
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)