SGN Marker T1671

SGN-M2180
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD16TH
Arabidopsis best BAC match: AF024504.2
Arabidopsis position: 2.1040000
Arabidopsis identities: 0.656
Best GenBank protein hit: CAB77958.1
Evalue: 3.6e-05
Identities: 0.265
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49481)
Chromosome
2
Position
41.38 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47415)
Chromosome
2
Position
90.44 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39737)
Chromosome
2
Position
82.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1671 was used as an overgo probe on plate 10 [well H11]

Plausible BAC Matches:   P080E01,   P117M20,   P179D24,   P159F19,   P010B01,   P311I10,   P290F04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCCCACCGGATTTTTACTTCGAAG
B sequence
GTACCTTTATTGCCGGCTTCGAAG
AB sequence
TCCCACCGGATTTTTACTTCGAAGCCGGCA
Marker sequence
GAATCGAACCCCTTCACCGTCAAAGATGGCATCAATCTACAGTTGTAAAG
AGTGCAATACAAACTTCAATCTCCATACCAACTATCTTTTCCCACCGGAT
TTTTACTTCGAAGCCGGCAATAAAGGTACTCTATCTTTCTCCGCTGTTGA
TTCATCCAAATTCAAGTTCGAGAAAGAAGATAAAATTAAACCCTTTTTCG
AAACCCTTGATTATTGGGGAATTCAGAGGAAAAGGACTAAGATGATGTGT
ATGAATTGTGGGAAGGTTGTGGGCTATGTGTATGATGACGGGCCACCCAT
GACTGAGAGTCCGGGTCAGTTTCATTTTGGTCCTAGTCAGGTTATTCCTA
GAGCTGCAAGGTATAGGATAAAAAATAAAGCTTTGAAGATTACTTCTGAG
ACTTGACATGTGATTTGATTTTTGATGTTCTTTTTTTTTAGATGTTGAGG
TTTGTATATGGATTTAAGAGATGTTTGATGTTTGTGTATATGAGATTTTG
ATTTTTAC
Genomic location of T1671  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2180 marker 2180
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)