SGN Marker solcap_snp_sl_3074

SGN-M21806

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72112)
Chromosome
4
Position
49.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68331)
Chromosome
4
Position
59.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64713)
Chromosome
4
Position
78.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58137)
Chromosome
4
Position
54.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGAAATCAAAGAAGCACCAGATATAATAGCTGACCTCCTATTCAATGA
  
3' flanking region
CCTGCAGATATCTCACAATCCCGGTTCATACGAGCATCTTCTTTAGAACA
SNP nucleotide
TG
SNPdb format
GATGAAATCAAAGAAGCACCAGATATAATAGCTGACCTCCTATTCAATGA[T/G]
CCTGCAGATATCTCACAATCCCGGTTCATACGAGCATCTTCTTTAGAACA
  
Genomic location of solcap_snp_sl_3074  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21806 marker 21806
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)