SGN Marker solcap_snp_sl_30838

SGN-M21823

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64724)
Chromosome
3
Position
49.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58154)
Chromosome
3
Position
49.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCACTTCAGTAACCGTAGTTATTGATATTGGACGCTTAGTGTACTTCAA
  
3' flanking region
CGTCCGTGAGTGAACTTGAGCGATTTATATAATCTCCTTAATCGAGCCGT
SNP nucleotide
AC
SNPdb format
CTCACTTCAGTAACCGTAGTTATTGATATTGGACGCTTAGTGTACTTCAA[A/C]
CGTCCGTGAGTGAACTTGAGCGATTTATATAATCTCCTTAATCGAGCCGT
  
Genomic location of solcap_snp_sl_30838  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21823 marker 21823
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)