SGN Marker T1677

SGN-M2184
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.03.04
Tomato EST read: TRZBD55TH
Arabidopsis best BAC match: AL035396.1
Arabidopsis position: 4.1280000
Arabidopsis identities: 0.686
Best GenBank protein hit: AAB71135.1
Evalue: 6.2e-86
Identities: 0.857
Description: UMP/CMP kinase [Arabidopsis thaliana]
Comment: pyrimidine-ribonucleotide metabolism
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49483)
Chromosome
1
Position
75.03 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47417)
Chromosome
1
Position
49.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39741)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1677 was used as an overgo probe on plate 9 [well F1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTTGGGTACACCCATCTAAGTGC
B sequence
TCGGAGAAGATCACCAGCACTTAG
AB sequence
CTTTGGGTACACCCATCTAAGTGCTGGTGA
Marker sequence
GGTTACCCAGAAATCCATGGGGACCTGTTGTCGAGTCTGCTAACCAGGGA
GCAGTAAGCCTGCCAACCAACAAGAAGGTCACTGTTATCTTTGTTCTAGG
TGGCCCAGGCAGTGGTAAGGGCACCCAATGTGCTAATATTGTTGAACACT
TTGGGTACACCCATCTAAGTGCTGGTGATCTTCTCCGAGCAGAAATAAAA
TCTGGTTCCGAGAATGGGACGATGATTTCGAACATGATTAAAGAAGGGAA
GATTGTTCCGTCAGAGGTAACAGTTAAGCTTCTCCAACGAGCAATTCAGG
AAAATGGCAATGACAAATTTCTTATTGATGGTTTCCCCCGGAATGAGGAG
AATCGTGCTGCTTTTGAGTTGGTCACTGGAATTGAGCCTGAGTTTGTGCT
CTTCTTTGATTGTCCTGAAGCAGAGATGGAGAAACGCCTTTTAGGTCGGA
ACCAGGGAAGAGAAGATGATAATATTGAAACAATAAAGAAGCGATTCAAC
GTTTACATGGAATCTAGTCTACCTGTTATTGAACATTACAACTCCAAGGG
GAAGGTTCGAAAGATTGATGCTGTAAAGCCTGTTGGAGAAGTATTTGAAG
CCGTTAAAGCTG
Genomic location of T1677  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2184 marker 2184
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)