Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1679

SGN-M2185
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD60TH
Arabidopsis best BAC match: AC006264.3
Arabidopsis position: 2.1210000
Arabidopsis identities: 0.480
Best GenBank protein hit: AAD29806.1
Evalue: 2.1e-47
Identities: 0.560
Description: putative disease resistance response protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39742)
Chromosome
1
Position
165.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1679 was used as an overgo probe on plate 3 [well B1]

Plausible BAC Matches:   P072N16

 Overgo Sequences

A sequence
ATATGGGTGGCTCAAGCACAAGAC
B sequence
TAGCCCATGACGTTTGGTCTTGTG
AB sequence
ATATGGGTGGCTCAAGCACAAGACCAAACG
Marker sequence
GCCAGCAAGTCCTTAGCATAACTCATATCTGGATCTTGCTCTCACGTATT
TTTTCCGCAAGTCATCACGAGATAGATCATGAAAAAAATTATTTTGCTTG
TCATATTTGCGAACCTATTTATATGGGTGGCTCAAGCACAAGACCAAACG
TCATGGGCTAAGAGAGTTGATACAGGCAAAGAGGTTGTTACAACTCTTCA
ATTCTACTTCCACGATAAACTCAGTGGATCAAACCCGAGTGCGGTTCAAA
TTGCACAAGCTGCTAGGACTAACAATTCGGGTACCTTATTTGGATCTTTG
TTGATGATTGATGATCCACTTACTATTGGACCTGACCCAACTTCAAAGCT
AATAGGTAGAGCCCGTGGACTATATGGGTCTGCTGGTCAAACTGATATGG
GCCTTATCATGGCAATTAGTTATGGGTTCTTGGATGGTATCTATCAAGGG
AGTTCATTTAGCCTATTGAGTTTGAACCCGGTAATGAACCCGGTTCGTGA
GATGGCTATCGTTGGTGGGACCGGACTTTTTCGGTTGGCCCGTGGGTATG
CTCTTGCTCAAACGTATTCGGCAAATCCTAATGGTGATGCAATTGTTGGC
TACAATGTTACAATTGTCACATATGTTTGAA
Genomic location of T1679  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2185 marker 2185
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)