SGN Marker solcap_snp_sl_31138

SGN-M21879

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58210)
Chromosome
11
Position
47.47 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATTACACAAAAAGCTGTATTTTGAACATCAAGTGATTAAAAATAACAA
  
3' flanking region
AGTTTAGAAAAAAAATCTTCATGACCTCAGTAAGCTCTGAGCAGCTTCCA
SNP nucleotide
AC
SNPdb format
ATATTACACAAAAAGCTGTATTTTGAACATCAAGTGATTAAAAATAACAA[A/C]
AGTTTAGAAAAAAAATCTTCATGACCTCAGTAAGCTCTGAGCAGCTTCCA
  
Genomic location of solcap_snp_sl_31138  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21879 marker 21879
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)