SGN Marker TG492

SGN-M219

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TCTTTCCTGCTATTATTCATTCAATATTTTAAATTCTTGTAGCATGTGATGAAATCCTGATAGAGTGCTATCCGAATTGATTTTGATGCT
AGGATGAAGTTGACGAAATAACTTGGCAAACTTACAAGGGACAGCTTACAGAGAAGCAGGAAAAAACACGTGAAAAAGTTGTGAAAAGAC
TTGAAAAGGTACCCGTTTACTTAATTTCTCTATGTTACTGTTAACCTGAAGGATCTCTTGAGGAAAAGTACCCCTTTGCAAATGTATGCG
AATCTTATTGTACCCCTTTTGATTTCAGATTGCTCATATGAAAAAAGAGATAGATGCTATTCGGGCCAAGGATATTTCTCAAGGTGGATT
GACACAGGGACAACAAACTCAAATTGCTCGTAATGAACAGAGGATATCACAGGTTAATAGCTCCTTCATCATTTTCTCTTTGATTC
Reverse sequence
CACCATATTTGTATGTATTAAAAAAAATAAAAAAAACTTAAAAATATCATCAACTTGAAGATGCATATTCAAGTTGATGATATTGAATGC
TGCCTATGTGATGGGAAAGTTATGGAAACAAATGAACACCTGTTTGAAAAATGCACATGGATGAAAAGTGTATGGCAGGAGATTAGTGAA
TGGACAGGTATTGCCTTGCAAAAAGAGGGGATCAATCAAGTACTAGGCAACATCAAAAAGAAACATTGGAAGCAATTTAAGGAGGAGGTA
ATTGCAGCCATTTGTGGAGCTGTTTTACACCACTTGGCAAATAAGAAATTGGAGAAGGTTCAAAGGGAAGCATGTACATACGAAAGAGGT
AGCAACACAGTTAAAGAAGGAGATAATAGAAAGGTTAAATTTAGTTAGTCATTCCAAGAAAGCACAGAAATGTAGTTCTTTCATTCAGCA
TTTACTTTGTAACTAGTTTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40063)
Chromosome
2
Position
111.90 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8637)
Chromosome
2
Position
113.56 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8633)
Chromosome
2
Position
89.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8634)
Chromosome
2
Position
97.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8638)
Chromosome
2
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG492 was used as an overgo probe on plate 16 [well G8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCGGGCCAAGGATATTTCTCAAGG
B sequence
TCCCTGTGTCAATCCACCTTGAGA
AB sequence
TCGGGCCAAGGATATTTCTCAAGGTGGATT
Marker sequence
TCTTTCCTGCTATTATTCATTCAATATTTTAAATTCTTGTAGCATGTGAT
GAAATCCTGATAGAGTGCTATCCGAATTGATTTTGATGCTAGGATGAAGT
TGACGAAATAACTTGGCAAACTTACAAGGGACAGCTTACAGAGAAGCAGG
AAAAAACACGTGAAAAAGTTGTGAAAAGACTTGAAAAGGTACCCGTTTAC
TTAATTTCTCTATGTTACTGTTAACCTGAAGGATCTCTTGAGGAAAAGTA
CCCCTTTGCAAATGTATGCGAATCTTATTGTACCCCTTTTGATTTCAGAT
TGCTCATATGAAAAAAGAGATAGATGCTATTCGGGCCAAGGATATTTCTC
AAGGTGGATTGACACAGGGACAACAAACTCAAATTGCTCGTAATGAACAG
AGGATATCACAGGTTAATAGCTCCTTCATCATTTTCTCTTTGATTC
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG492  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D219 marker 219
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)