Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1684

SGN-M2190
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.04
Tomato EST read: TRZBF09TH
Arabidopsis best BAC match: AC027034.8
Arabidopsis position: 1.0994000
Arabidopsis identities: 0.892
Best GenBank protein hit: AAG12945.1
Evalue: 3.8e-94
Identities: 0.879
Description: hypothetical protein; 34572-37079 [Arabidopsis thaliana]
Comment: also high similarity to RNA helicases in several species
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49485)
Chromosome
12
Position
45.65 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47419)
Chromosome
12
Position
59.11 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39747)
Chromosome
12
Position
62.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1684 was used as an overgo probe on plate 1 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCGTCAGCATGTGGAAATCGTCTC
B sequence
ATACTTCTGGCTCTCCGAGACGAT
AB sequence
TCGTCAGCATGTGGAAATCGTCTCGGAGAG
Marker sequence
GGCTGTATTGGAGTGCCACATGGCCCAAAGAAGTTGAGCAGCTTGCAAGA
CAATTCCTTTTCAATGCATACAAAGTAATTATTGGTTCAGCTGACCTGAA
AGCTAATCACGCTATTCGTCAGCATGTGGAAATCGTCTCGGAGAGCCAGA
AGTATAATAAATTAGTAAAGTTGCTGGAAGATATTATGGATGGTAGTCGG
ATTTTAATATTCATGGACACTAAAAAGGGGTGTGACCAAGTAACTCGGCA
GCTCCGGATGGATGGTTGGCCGGCACTTTCTATTCATGGTGATAAGAGTC
AAGCAGAAAGAGATTGGGTCCTTTCAGAATTCAAAGCTGGAAAGTCTCCT
ATAATGACAGCTACAGACGTTGCTGCTCGAGGTCTAGATGTGAAGGATGT
AAAGTTTGTAATCAACTATGATTTTCCTGGATCATTGGAGGACTATGTTC
ACCGAATTGGTAGAACGGGAAGAGCTGGTGCCTCAGGGACAGCATACACA
TTCTTTACTGCAGCGAATGCTAGGTTTGCGAAGGACCTTGTTAACATTCT
TGAGGAGGCTGGACAGAAAGTCAGTCCTGAATTGGCAAAAATGGGACGTG
GTGCTCCTCCCCCTCCTGGTCAC
Genomic location of T1684  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2190 marker 2190
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)