SGN Marker solcap_snp_sl_31389

SGN-M21915

Synonyms  
SGN-U567105_snp715
SGN-U567105_snp715_solcap_snp_sl_31389
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70390)
Chromosome
12
Position
83.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66921)
Chromosome
12
Position
97.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63403)
Chromosome
12
Position
140.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58246)
Chromosome
12
Position
64.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATCTTTACCACACTCTCTTCCTTCAAATTTTCATCATCCAAACCCGTAG
  
3' flanking region
TAACACGGATGAATCCTTACCGTCATAACCATCCAAAATCTTCACATCAT
SNP nucleotide
TC
SNPdb format
CATCTTTACCACACTCTCTTCCTTCAAATTTTCATCATCCAAACCCGTAG[T/C]
TAACACGGATGAATCCTTACCGTCATAACCATCCAAAATCTTCACATCAT
  
Genomic location of solcap_snp_sl_31389  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21915 marker 21915
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)