SGN Marker solcap_snp_sl_31464

SGN-M21919

Synonyms  
SGN-U317539_snp95
SGN-U317539_snp95_solcap_snp_sl_31464
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70359)
Chromosome
12
Position
82.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66892)
Chromosome
12
Position
93.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63376)
Chromosome
12
Position
137.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58250)
Chromosome
12
Position
64.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTTAGGACAAACAAATTGAAACGACGAACGAATAAACATTACCTTATA
  
3' flanking region
GAAAAGGCACAATTCTTCAAAGGATCTTTCCAAGCTTGAGGAGGATTAGA
SNP nucleotide
TC
SNPdb format
TTGTTAGGACAAACAAATTGAAACGACGAACGAATAAACATTACCTTATA[T/C]
GAAAAGGCACAATTCTTCAAAGGATCTTTCCAAGCTTGAGGAGGATTAGA
  
Genomic location of solcap_snp_sl_31464  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21919 marker 21919
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)