SGN Marker T1687

SGN-M2192
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TRZBF32TH
Arabidopsis best BAC match: AC003970.1
Arabidopsis position: 1.0260000
Arabidopsis identities: 0.900
Best GenBank protein hit: AAC33203.1
Evalue: 1.1e-85
Identities: 0.913
Description: Similar to ATP-citrate-lyase [Arabidopsis thaliana]
Comment: no matches to characterized genes
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39749)
Chromosome
1
Position
117.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1687 was used as an overgo probe on plate 8 [well C11]

Plausible BAC Matches:   P023C13,   P131O24,   P255L02

 Non-Plausible BAC matches

P268O15,   P118A08,   P255L03

 Overgo Sequences

A sequence
GCTGGCATTGATCTTCAGATCTGC
B sequence
CTGTCACTTGAGCAGAGCAGATCT
AB sequence
GCTGGCATTGATCTTCAGATCTGCTCTGCT
Marker sequence
GGTAATATGGCGAGGAAGAAGATCAGAGAGTATGATTCAAAGAGGCTTCT
AAGGGAGCATTTGAAACGCCTTGCTGGCATTGATCTTCAGATCTGCTCTG
CTCAAGTGACAGAATCTACAGATTTTACTGAGTTAACAAACAAAGAACCA
TGGCTTTCATCGACAAAGCTGGTTGTAAAACCAGACATGCTGTTTGGAAA
GCGTGGAAAGAGTGGCTTGGTAGCTTTGAATCTGGATCTAGCAGGAGTTG
CTGAGTTTGTAAAAACACGACTTGGTGTGGAGGTTGAAATGGGTGGCTGC
AAGGCACCTATAACAACATTTATTGTTGAACCATTTGTTCCCCATGACCA
AGAATATTACCTTTCCATAGTCTCTGAAAGGTTGGGCTGCACAATTAGCT
TTTCAGAATGTGGAGGCATTGAGATTGAAGAGAACTGGGACAAGGTCAAG
ACAATATTCCTTCCAACGGAGAAACCTATGACCCTAGAGGCGTGTGCTCC
ACTGATTGCTACTCTGCCCTTGGAGGTGATCTGAAATTNTTGTTTTTGTT
TTATGCTTCTACTTTCCTTTTAGTCATCAGTCTCGATCAAGCCAGCATGA
TCTGTCAGTCATAATA
Genomic location of T1687  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2192 marker 2192
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)