SGN Marker T1688

SGN-M2193
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBF48TH
Arabidopsis best BAC match: AC007396.6
Arabidopsis position: 1.1415000
Arabidopsis identities: 0.847
Best GenBank protein hit: AAF26769.2
Evalue: 4.7e-36
Identities: 0.477
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39750)
Chromosome
4
Position
132.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1688 was used as an overgo probe on plate 7 [well E3]

Plausible BAC Matches:   P157B13,   P306G17

 Overgo Sequences

A sequence
ATTTCCGATGACGGAGCAAAACGC
B sequence
AGTGTTGGCTTCGTCAGCGTTTTG
AB sequence
ATTTCCGATGACGGAGCAAAACGCTGACGA
Marker sequence
GCTTCAACTGGCCGGAGTTGCTTCCAATTTCCGATGACGGAGCAAAACGC
TGACGAAGCCAACACTGTTCAAACTTCGAATATTGACAATGTAGAACTGG
CAATAGTTGATGGCTCTCATTCCGACACCGCCCAGAAATCAGAACCACTA
ATTGAAGAACTACAAGATGAAGAACTAAGGAAACTTTTGGTGCCGAAGTT
AGAAAACCTCCCAATTTCTCCTCCTTCTGCTGTTGAATCCAATTTCGTCA
CCTATTTTGCTCCTGATTTTATGAAACCTGGGCATGATCAGTATGTTCAT
CGACATGCCAATGGATTGTGCATAATTGGGTTGGCTCCGACCCACATTGC
TTTTAAGGATGAAGGCGGAGTTACTTCGGTTGATTTCAATGTGGGGAAGT
CTGATCGGAGTGGAATCAAGGTCTCTGGAAAGCGAAAAAAGAACGCTCAA
CATTTTGAGTCTAATACAGCATTATGTAAAGCCTGCACAAAGGATGGTTC
TTATATTGTGAGGTGTTGTGTGAAAAGCTCGTTATTAGAAGTCAATGATA
GG
Genomic location of T1688  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2193 marker 2193
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)