SGN Marker T1689

SGN-M2194
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBF68TH
Arabidopsis best BAC match: AL132955.1
Arabidopsis position: 3.1105000
Arabidopsis identities: 0.555
Best GenBank protein hit: CAB61990.1
Evalue: 2.1e-37
Identities: 0.517
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39751)
Chromosome
3
Position
122.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1689 was used as an overgo probe on plate 2 [well B6]

Plausible BAC Matches:   P134P07

 Overgo Sequences

A sequence
CTGCAGAATGAGGTCAAAGCAAGG
B sequence
GACTAGTCTCAGCTTCCCTTGCTT
AB sequence
CTGCAGAATGAGGTCAAAGCAAGGGAAGCT
Marker sequence
CTCATCAAAGGCTACACCGTGGACTCGAATAAGAGATGGATACAGAAAAT
CCTGCTCCAATAGTTGAAAAGGATACTACAGATGCGGAGACATCATTGGA
TAGCTCTCATCTCAGGAAGAAGATTCAGAAGAAAGTTCCAAAAAGAATTC
ACAAAGCTGAGAGAGAGAAAATGAAGAGAGAGCATTTAAATGAGCTTTTT
CTTGGTTTGGCTGATGCTCTTGAACTATCTGAGCAGATGAATGGAAAAGC
CTCTGTATTGAGTGAAGCTGCTCGATTTGTAAAGGACATGCTTTCTCAGA
TCAAGCATATGAGGACAGAAAATACGACTTTGCTGTCTGAATCTCAATAT
CTTAGCGTGGAGAAAAAGGAGCTTGAGGATGAAAATACAGTTCTGGAGGC
TGAAATTAGCAAACTGCAGAATGAGGTCAAAGCAAGGGAAGCTGAGACTA
GTCTTGACCTAAATCTAGCTCCTCCTGAAATTCATCACACAGAGTTTGCC
TCACAAACTAACTATATGAGATTGCCTGCTTCGGAGCACGGATTTCAACA
GTCACAGATGATGAACCCCGTGTACGTCTTTCCCTTGAGTTCTAATCCTC
AGGCTTATCCAGCGCCTGATGCTGCAGATCCCATGGCTATGCCCTCATCT
ACTG
Genomic location of T1689  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2194 marker 2194
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)