SGN Marker solcap_snp_sl_31701

SGN-M21949

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72182)
Chromosome
6
Position
65.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68378)
Chromosome
6
Position
81.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64763)
Chromosome
6
Position
99.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58280)
Chromosome
6
Position
44.83 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTTCACATATTTCCTCTGTGGTTACATTTATGGCCCTCAGCAAAATTGC
  
3' flanking region
ATGTTTTGTGCTTTCTTTGGATCAAGTACCCTATTCTCTTGGCTCGGTGA
SNP nucleotide
AG
SNPdb format
GCTTCACATATTTCCTCTGTGGTTACATTTATGGCCCTCAGCAAAATTGC[A/G]
ATGTTTTGTGCTTTCTTTGGATCAAGTACCCTATTCTCTTGGCTCGGTGA
  
Genomic location of solcap_snp_sl_31701  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21949 marker 21949
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)