SGN Marker solcap_snp_sl_31729

SGN-M21963

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72184)
Chromosome
6
Position
63.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68381)
Chromosome
6
Position
78.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64766)
Chromosome
6
Position
95.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58294)
Chromosome
6
Position
44.54 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTTTATTCAAATACTATTGTTGATGTAAAGTTACAAAAAAACAAAAAA
  
3' flanking region
AGTGAGTGGAAGTTCATATTGTAGATACATACCATTTTCTTGTCTTCTAT
SNP nucleotide
TC
SNPdb format
TTTTTTATTCAAATACTATTGTTGATGTAAAGTTACAAAAAAACAAAAAA[T/C]
AGTGAGTGGAAGTTCATATTGTAGATACATACCATTTTCTTGTCTTCTAT
  
Genomic location of solcap_snp_sl_31729  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21963 marker 21963
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)