Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_3174

SGN-M21970

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72185)
Chromosome
12
Position
4.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68382)
Chromosome
12
Position
9.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64767)
Chromosome
12
Position
14.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58301)
Chromosome
12
Position
0.90 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTACAGGCATGGACCTCTGAGCAAAATTCAACAACAGCTTCCTCTGGTG
  
3' flanking region
TCATTCGTGTGTGGGAGACTAGCACGTAAGAGTTCGACTGGCATTTCTCT
SNP nucleotide
TC
SNPdb format
GTTACAGGCATGGACCTCTGAGCAAAATTCAACAACAGCTTCCTCTGGTG[T/C]
TCATTCGTGTGTGGGAGACTAGCACGTAAGAGTTCGACTGGCATTTCTCT
  
Genomic location of solcap_snp_sl_3174  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21970 marker 21970
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)