SGN Marker solcap_snp_sl_31817

SGN-M21976

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72188)
Chromosome
3
Position
32.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68384)
Chromosome
3
Position
39.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58307)
Chromosome
3
Position
7.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTCACCCAAAGCGGTAGAGTCACAGGCTGCTCTCAGGGAGAAAAAAGT
  
3' flanking region
TCGGAAATGATGAATTTTCTTAGGTCTAGAAAAGGGGAAACTGTGAAGAT
SNP nucleotide
AT
SNPdb format
TTCTCACCCAAAGCGGTAGAGTCACAGGCTGCTCTCAGGGAGAAAAAAGT[A/T]
TCGGAAATGATGAATTTTCTTAGGTCTAGAAAAGGGGAAACTGTGAAGAT
  
Genomic location of solcap_snp_sl_31817  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21976 marker 21976
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)